Clarity Oligo-RP

Колонки Clarity Oligo-RP специально разработаны для обращённо-фазовой очистки олигонуклеотидов с соблюдением баланса между гидрофобностью и полярной селективностью. Частицы сорбента выполнены по композитной TWIN™ технологии. Эта технология даёт лучшую селективность и эффективность при работе с олигонуклеотидами по сравнению с другими имеющимися на рынке гибридными и полимерными сорбентами или сорбентами на основе силикагеля. Колонки Clarity Oligo-RP выпускаются в широком диапазоне размеров с частицами сорбента 3, 5 и 10 мкм.

  • Отделение до 90% ошибочных N-1 цепочек от целевого олигонуклеотида.
  • Очистка не защищённых тритильной группой ДНК, РНК, тиоатов и модифицированных/меченных олигонуклеотидов.
  • Препаративные колонки для загрузки > 5 мкмоль.
  • Очистка олигонуклеотидов длиной до 60 оснований.
  • Отличные колонки для задач контроля качества методом обращённо-фазовой ВЭЖХ.

Сорбент Oligo-RP специально разработан так, чтобы совместить все возможные способы нуклеотидов взаимодействовать друг с другом. Сорбент обладает гидрофобной, дипольной, п-п и водородной связью донорно-акцепторных участков. Благодаря этой комбинаций взаимодействий и ион-парному реагенту достигается высокий уровень избирательной селективности между нуклеиновыми кислотами. Oligo-RP может распознать даже незначительные изменения в цепочке нуклеотидов, например, разницу в одно основание (N и N-1) или замену одного основания другим.

Разделение ошибочной цепочки длины N-1 и целевой цепочки длины N

Образцы:
1. Цепочка РНК из 20 оснований:
CUGUAAUCUCUUGUCUATT
2. Цепочка РНК из 21 основания:
UCUGUAAUCUCUUGUCUATT
Колонка: Clarity Oligo-RP C18 50х4.6 мм 3 мкм
Подвижная фаза: A: 10 мМ гексафторизопропанол; B: метанол
Градиент: c A/B (75:25) до A/B (55:45) за 80 мин
Расход: 1 мл/мин
Детектирование: УФ 260 нм

Разрешение примесей в цепочке ДНК из 60 оснований

Образец:
Цепочка ДНК из 60 оснований:
5’-CTC CTG GGC CGT GGC TCT GCG CAC TTC AGG AAA CTG GGC ACT CCT GGG CAG TGG ATC TGC-3’
Номера пиков обозначают длину цепочки присутствующей примеси
Колонка: Clarity Oligo-RP C18 50х4.6 мм 3 мкм
Подвижная фаза: A: 50 мМ триэтиламмоний ацетат pH 7.5/5% ацетонитрил; B: метанол
Градиент: с 20% до 25% B за 20 мин; держать 25% В - 5 мин
Расход: 1 мл/мин
Детектирование: УФ 260 нм

Обращённо-фазовое разделение олигонуклеотидов имеет преимущество перед другими методами разделения, такими как ионный обмен. Фаза Oligo-RP предусматривает высокую нагрузочную способность и обеспечивает высокую степень восстановления и чистоты, устраняя необходимость в дополнительных стадиях очистки, таких как обессоливание. Так как обращенно-фазовая ВЭЖХ обладает чрезвычайно высоким разрешением, колонки Oligo-RP позволяют легко отделить целевой олигонуклеотид от многих примесей, таких как N-1 ошибочные цепочки. Кроме того, с помощью одной колонки можно разделять и ДНК, и РНК, и модифицированные олигонуклеотиды.

Препаративная очистка ДНК

Колонка: Clarity Oligo-RP C18 3 мкм
50х10 мм (препаративная)
50х4.6 мм (аналитическая)
Подвижная фаза: A: 50 мМ триэтиламмоний ацетат pH 7.5/5% ацетонитрил;
B: метанол
Градиент: с A/B (90:10) до A/B (40:60) за 20 мин
Расход: 1 мл/мин
Детектирование: УФ 260 нм
Образец: цепочка ДНК из 20 оснований
ACGTCATGTCGAGATCATCG
200 мкг (1 мкмоль) образца 20-мерной ДНК были загружены в препаративную колонку Clarity Oligo-RP с внутренним диаметром 10 мм. В результате примеси были удалены из целевой цепочки.
Для проверки качества препаративной очистки был проведён анализ на аналитической колонке. Подтверждена степень очистки 92% при выходе 85%.

Очистка меченных ДНК с различным содержание GC

Образцы:
1. FAM-меченная ДНК (25 оснований) GC: 72%
2. FAM-меченная ДНК (25 оснований) GC: 56%
3. FAM-меченная ДНК (25 оснований) GC: 20%
Колонка: Clarity Oligo-RP C18 50х4.6 мм 3 мкм
Подвижная фаза: A: 50 мМ триэтиламмоний ацетат pH 7.5/5% ацетонитрил; B: метанол
Градиент: с A/B (90:10) до A/B (40:60) за 20 мин
Расход: 1 мл/мин
Детектирование: УФ 260 нм

Информация для заказа

Колонки малого диаметра
Номер по каталогу
Phenomenex
Зернение,
мкм
Размер колонки, мм
(длина х диаметр)
00B-4441-B0 3 50x2,0
00D-4441-B0 3 100x2,0
00F-4441-B0 3 150x2,0
00F-4442-B0 5 150x2,0

Аналитические колонки
Номер по каталогу
Phenomenex
Зернение,
мкм
Размер колонки, мм
(длина х диаметр)
00B-4441-E0 3 50x4,6
00D-4441-E0 3 100х4,6
00F-4441-E0 3 150х4,6
00B-4442-E0 5 50x4,6
00F-4442-E0 5 150x4,6
00G-4442-E0 5 250x4,6
00F-4445-E0 10 150х4,6

Полупрепаративные и препаративные колонки
Номер по каталогу
Phenomenex
Зернение,
мкм
Размер колонки, мм
(длина х диаметр)
00B-4441-N0 3 50x10
00B-4442-N0 5 50x10
00D-4442-N0 5 100x10
00F-4442-N0 5 150x10
00G-4442-N0 5 250х10
00D-4442-P0-AX 5 100х21.2
00G-4442-P0-AX 5 250х21.2
00D-4442-U0-AX 5 100х30
00F-4445-N0 10 150x10
00G-4445-N0 10 250x10
00F-4445-P0-AX 10 150х21.2
00G-4445-P0-AX 10 250х21.2
00F-4445-U0-AX 10 150х30
00G-4445-V0-AX 10 250х50

Система защиты колонок SecurityGuard
Номер по каталогу
Phenomenex
Описание Размер,
мм
Рекомендуется для
колонок с внутренним
диаметром, мм
KJ0-4282

Security Guard Kit, включающий
держатель картриджа 2-3 мм ID

- 2-8
AJ0-9281 держатель картриджа 10 мм ID - 9-16
AJ0-8223 держатель картриджа 21.2 мм ID - 18-29
AJ0-8277 держатель картриджа 30 мм ID - 30-49
AJ0-8134 защитный картридж 4x2,0 2-3
AJ0-8135 защитный картридж 4x3,0 3.2-8
AJ0-8136 защитный картридж 10x10 9-16
AJ0-8210 защитный картридж 15x21.2 18-29
AJ0-8310 защитный картридж 15x30 30-49
Copyright © АО "Аквилон"